ID: 918725859

View in Genome Browser
Species Human (GRCh38)
Location 1:187922711-187922733
Sequence TACTGCTGCCTGGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918725859_918725861 20 Left 918725859 1:187922711-187922733 CCAGTTTTTGCCAGGCAGCAGTA No data
Right 918725861 1:187922754-187922776 GCAAAAATATGCAGTAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918725859 Original CRISPR TACTGCTGCCTGGCAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr