ID: 918727342

View in Genome Browser
Species Human (GRCh38)
Location 1:187942322-187942344
Sequence CACAAGGTCCTGCCTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918727342_918727344 1 Left 918727342 1:187942322-187942344 CCAGCAGGAGGCAGGACCTTGTG No data
Right 918727344 1:187942346-187942368 AAGTCCAGTTTCCAAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918727342 Original CRISPR CACAAGGTCCTGCCTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr