ID: 918733880

View in Genome Browser
Species Human (GRCh38)
Location 1:188033817-188033839
Sequence GCTCTGAATAGACCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918733880_918733883 5 Left 918733880 1:188033817-188033839 CCTGTTTTTGGTCTATTCAGAGC No data
Right 918733883 1:188033845-188033867 CTTATTCCTGGTTTAGTCTTGGG 0: 53
1: 8376
2: 3808
3: 1880
4: 1537
918733880_918733885 23 Left 918733880 1:188033817-188033839 CCTGTTTTTGGTCTATTCAGAGC No data
Right 918733885 1:188033863-188033885 TTGGGAGAATGTATGTGTCGAGG 0: 18
1: 2102
2: 3214
3: 5027
4: 3902
918733880_918733881 -7 Left 918733880 1:188033817-188033839 CCTGTTTTTGGTCTATTCAGAGC No data
Right 918733881 1:188033833-188033855 TCAGAGCTTCAACTTATTCCTGG No data
918733880_918733882 4 Left 918733880 1:188033817-188033839 CCTGTTTTTGGTCTATTCAGAGC No data
Right 918733882 1:188033844-188033866 ACTTATTCCTGGTTTAGTCTTGG 0: 45
1: 8020
2: 4025
3: 2162
4: 2277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918733880 Original CRISPR GCTCTGAATAGACCAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr