ID: 918738456

View in Genome Browser
Species Human (GRCh38)
Location 1:188096886-188096908
Sequence TCCCCACCCCTAGAATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918738448_918738456 13 Left 918738448 1:188096850-188096872 CCTTCACTCTCCCATGACCAGTG No data
Right 918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG No data
918738449_918738456 3 Left 918738449 1:188096860-188096882 CCCATGACCAGTGATGCCACCTA No data
Right 918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG No data
918738451_918738456 -4 Left 918738451 1:188096867-188096889 CCAGTGATGCCACCTACCCTCCC No data
Right 918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG No data
918738445_918738456 30 Left 918738445 1:188096833-188096855 CCTGACATATTTTCCTCCCTTCA No data
Right 918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG No data
918738446_918738456 17 Left 918738446 1:188096846-188096868 CCTCCCTTCACTCTCCCATGACC No data
Right 918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG No data
918738450_918738456 2 Left 918738450 1:188096861-188096883 CCATGACCAGTGATGCCACCTAC No data
Right 918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG No data
918738447_918738456 14 Left 918738447 1:188096849-188096871 CCCTTCACTCTCCCATGACCAGT No data
Right 918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918738456 Original CRISPR TCCCCACCCCTAGAATCCCC AGG Intergenic
No off target data available for this crispr