ID: 918743186

View in Genome Browser
Species Human (GRCh38)
Location 1:188163168-188163190
Sequence GGCACCCAAGTCTTCATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918743183_918743186 25 Left 918743183 1:188163120-188163142 CCAAGGCATAAAAATTGAAGGGC No data
Right 918743186 1:188163168-188163190 GGCACCCAAGTCTTCATTTCAGG No data
918743185_918743186 -6 Left 918743185 1:188163151-188163173 CCTTTATTCTTAAAAATGGCACC No data
Right 918743186 1:188163168-188163190 GGCACCCAAGTCTTCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918743186 Original CRISPR GGCACCCAAGTCTTCATTTC AGG Intergenic
No off target data available for this crispr