ID: 918746795

View in Genome Browser
Species Human (GRCh38)
Location 1:188211714-188211736
Sequence AGGTCACTGGTAACCTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918746795_918746798 -3 Left 918746795 1:188211714-188211736 CCTGTTAAGGTTACCAGTGACCT No data
Right 918746798 1:188211734-188211756 CCTCTAGTATGCCAAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918746795 Original CRISPR AGGTCACTGGTAACCTTAAC AGG (reversed) Intergenic