ID: 918748061

View in Genome Browser
Species Human (GRCh38)
Location 1:188231763-188231785
Sequence TGTTATCTGCAGATGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918748061_918748065 -7 Left 918748061 1:188231763-188231785 CCTTCCAGCATCTGCAGATAACA No data
Right 918748065 1:188231779-188231801 GATAACATGTATATATATAGGGG No data
918748061_918748063 -9 Left 918748061 1:188231763-188231785 CCTTCCAGCATCTGCAGATAACA No data
Right 918748063 1:188231777-188231799 CAGATAACATGTATATATATAGG No data
918748061_918748064 -8 Left 918748061 1:188231763-188231785 CCTTCCAGCATCTGCAGATAACA No data
Right 918748064 1:188231778-188231800 AGATAACATGTATATATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918748061 Original CRISPR TGTTATCTGCAGATGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr