ID: 918750947

View in Genome Browser
Species Human (GRCh38)
Location 1:188268590-188268612
Sequence AAACCCTGCTTCACAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918750945_918750947 20 Left 918750945 1:188268547-188268569 CCAGTCTACTCTGTAATCTTGTT No data
Right 918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918750947 Original CRISPR AAACCCTGCTTCACAAAAAT AGG Intergenic
No off target data available for this crispr