ID: 918755710

View in Genome Browser
Species Human (GRCh38)
Location 1:188337772-188337794
Sequence ATGGCTCTTGGCCCGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918755710_918755716 12 Left 918755710 1:188337772-188337794 CCCAGTAACGGGCCAAGAGCCAT No data
Right 918755716 1:188337807-188337829 GAGTAGTTATCTGGAGAAGATGG No data
918755710_918755718 17 Left 918755710 1:188337772-188337794 CCCAGTAACGGGCCAAGAGCCAT No data
Right 918755718 1:188337812-188337834 GTTATCTGGAGAAGATGGAAGGG No data
918755710_918755715 3 Left 918755710 1:188337772-188337794 CCCAGTAACGGGCCAAGAGCCAT No data
Right 918755715 1:188337798-188337820 TCAAAAGGAGAGTAGTTATCTGG 0: 5
1: 16
2: 4
3: 16
4: 163
918755710_918755717 16 Left 918755710 1:188337772-188337794 CCCAGTAACGGGCCAAGAGCCAT No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918755710 Original CRISPR ATGGCTCTTGGCCCGTTACT GGG (reversed) Intergenic
No off target data available for this crispr