ID: 918755714

View in Genome Browser
Species Human (GRCh38)
Location 1:188337791-188337813
Sequence ACTACTCTCCTTTTGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918755714_918755717 -3 Left 918755714 1:188337791-188337813 CCATCTCTCAAAAGGAGAGTAGT No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data
918755714_918755718 -2 Left 918755714 1:188337791-188337813 CCATCTCTCAAAAGGAGAGTAGT No data
Right 918755718 1:188337812-188337834 GTTATCTGGAGAAGATGGAAGGG No data
918755714_918755716 -7 Left 918755714 1:188337791-188337813 CCATCTCTCAAAAGGAGAGTAGT No data
Right 918755716 1:188337807-188337829 GAGTAGTTATCTGGAGAAGATGG No data
918755714_918755719 20 Left 918755714 1:188337791-188337813 CCATCTCTCAAAAGGAGAGTAGT No data
Right 918755719 1:188337834-188337856 GCCTTCCTCCAAAATTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918755714 Original CRISPR ACTACTCTCCTTTTGAGAGA TGG (reversed) Intergenic
No off target data available for this crispr