ID: 918755717

View in Genome Browser
Species Human (GRCh38)
Location 1:188337811-188337833
Sequence AGTTATCTGGAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918755714_918755717 -3 Left 918755714 1:188337791-188337813 CCATCTCTCAAAAGGAGAGTAGT No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data
918755708_918755717 25 Left 918755708 1:188337763-188337785 CCACCAAAACCCAGTAACGGGCC No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data
918755713_918755717 4 Left 918755713 1:188337784-188337806 CCAAGAGCCATCTCTCAAAAGGA No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data
918755710_918755717 16 Left 918755710 1:188337772-188337794 CCCAGTAACGGGCCAAGAGCCAT No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data
918755711_918755717 15 Left 918755711 1:188337773-188337795 CCAGTAACGGGCCAAGAGCCATC No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data
918755709_918755717 22 Left 918755709 1:188337766-188337788 CCAAAACCCAGTAACGGGCCAAG No data
Right 918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918755717 Original CRISPR AGTTATCTGGAGAAGATGGA AGG Intergenic
No off target data available for this crispr