ID: 918755721

View in Genome Browser
Species Human (GRCh38)
Location 1:188337839-188337861
Sequence AAGGGCCTCTAGAATTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918755721_918755727 -4 Left 918755721 1:188337839-188337861 CCTCCAAAATTCTAGAGGCCCTT No data
Right 918755727 1:188337858-188337880 CCTTCTTTGATTTACCTATGGGG No data
918755721_918755725 -5 Left 918755721 1:188337839-188337861 CCTCCAAAATTCTAGAGGCCCTT No data
Right 918755725 1:188337857-188337879 CCCTTCTTTGATTTACCTATGGG No data
918755721_918755728 -3 Left 918755721 1:188337839-188337861 CCTCCAAAATTCTAGAGGCCCTT No data
Right 918755728 1:188337859-188337881 CTTCTTTGATTTACCTATGGGGG No data
918755721_918755723 -6 Left 918755721 1:188337839-188337861 CCTCCAAAATTCTAGAGGCCCTT No data
Right 918755723 1:188337856-188337878 GCCCTTCTTTGATTTACCTATGG No data
918755721_918755729 8 Left 918755721 1:188337839-188337861 CCTCCAAAATTCTAGAGGCCCTT No data
Right 918755729 1:188337870-188337892 TACCTATGGGGGCCTGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918755721 Original CRISPR AAGGGCCTCTAGAATTTTGG AGG (reversed) Intergenic
No off target data available for this crispr