ID: 918761847

View in Genome Browser
Species Human (GRCh38)
Location 1:188420536-188420558
Sequence AGGGAGAGACAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11072
Summary {0: 2, 1: 6, 2: 142, 3: 1417, 4: 9505}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918761847 Original CRISPR AGGGAGAGACAGAAGGAGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr