ID: 918763900

View in Genome Browser
Species Human (GRCh38)
Location 1:188453630-188453652
Sequence TTGCCCAACCACATTGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918763897_918763900 8 Left 918763897 1:188453599-188453621 CCAGAACAGATTCATTACAAATT No data
Right 918763900 1:188453630-188453652 TTGCCCAACCACATTGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918763900 Original CRISPR TTGCCCAACCACATTGGTAT AGG Intergenic
No off target data available for this crispr