ID: 918765599

View in Genome Browser
Species Human (GRCh38)
Location 1:188479156-188479178
Sequence GCGCGCGCGCGTGTTGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918765598_918765599 27 Left 918765598 1:188479106-188479128 CCTTCTTAGCTGCTTTTAATGTG No data
Right 918765599 1:188479156-188479178 GCGCGCGCGCGTGTTGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918765599 Original CRISPR GCGCGCGCGCGTGTTGACAT TGG Intergenic
No off target data available for this crispr