ID: 918765740

View in Genome Browser
Species Human (GRCh38)
Location 1:188480925-188480947
Sequence CAAATGATGAAACCAGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918765740_918765742 3 Left 918765740 1:188480925-188480947 CCCAGTACTGGTTTCATCATTTG No data
Right 918765742 1:188480951-188480973 TTAATTCTGTGCTGCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918765740 Original CRISPR CAAATGATGAAACCAGTACT GGG (reversed) Intergenic
No off target data available for this crispr