ID: 918774492

View in Genome Browser
Species Human (GRCh38)
Location 1:188610745-188610767
Sequence AGTCATTTGCTGAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918774492_918774495 15 Left 918774492 1:188610745-188610767 CCTTCCATCTTCAGCAAATGACT No data
Right 918774495 1:188610783-188610805 GACATCTCTTTGCCTGTTACTGG No data
918774492_918774497 22 Left 918774492 1:188610745-188610767 CCTTCCATCTTCAGCAAATGACT No data
Right 918774497 1:188610790-188610812 CTTTGCCTGTTACTGGGCTTTGG No data
918774492_918774496 16 Left 918774492 1:188610745-188610767 CCTTCCATCTTCAGCAAATGACT No data
Right 918774496 1:188610784-188610806 ACATCTCTTTGCCTGTTACTGGG No data
918774492_918774498 25 Left 918774492 1:188610745-188610767 CCTTCCATCTTCAGCAAATGACT No data
Right 918774498 1:188610793-188610815 TGCCTGTTACTGGGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918774492 Original CRISPR AGTCATTTGCTGAAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr