ID: 918775181

View in Genome Browser
Species Human (GRCh38)
Location 1:188619811-188619833
Sequence CACATATATCATTATAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918775181_918775182 -5 Left 918775181 1:188619811-188619833 CCAAGCTTATAATGATATATGTG No data
Right 918775182 1:188619829-188619851 ATGTGAATATACGACATGAAAGG No data
918775181_918775183 -4 Left 918775181 1:188619811-188619833 CCAAGCTTATAATGATATATGTG No data
Right 918775183 1:188619830-188619852 TGTGAATATACGACATGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918775181 Original CRISPR CACATATATCATTATAAGCT TGG (reversed) Intergenic
No off target data available for this crispr