ID: 918775220

View in Genome Browser
Species Human (GRCh38)
Location 1:188620188-188620210
Sequence TTCCATGTGTTTTCACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918775220_918775222 -1 Left 918775220 1:188620188-188620210 CCACTATGTGAAAACACATGGAA No data
Right 918775222 1:188620210-188620232 AGATGACATTAATGAAGAACGGG No data
918775220_918775221 -2 Left 918775220 1:188620188-188620210 CCACTATGTGAAAACACATGGAA No data
Right 918775221 1:188620209-188620231 AAGATGACATTAATGAAGAACGG No data
918775220_918775225 25 Left 918775220 1:188620188-188620210 CCACTATGTGAAAACACATGGAA No data
Right 918775225 1:188620236-188620258 TCTCAAGTCATCAAATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918775220 Original CRISPR TTCCATGTGTTTTCACATAG TGG (reversed) Intergenic