ID: 918775222

View in Genome Browser
Species Human (GRCh38)
Location 1:188620210-188620232
Sequence AGATGACATTAATGAAGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918775218_918775222 4 Left 918775218 1:188620183-188620205 CCATTCCACTATGTGAAAACACA No data
Right 918775222 1:188620210-188620232 AGATGACATTAATGAAGAACGGG No data
918775220_918775222 -1 Left 918775220 1:188620188-188620210 CCACTATGTGAAAACACATGGAA No data
Right 918775222 1:188620210-188620232 AGATGACATTAATGAAGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918775222 Original CRISPR AGATGACATTAATGAAGAAC GGG Intergenic
No off target data available for this crispr