ID: 918775225

View in Genome Browser
Species Human (GRCh38)
Location 1:188620236-188620258
Sequence TCTCAAGTCATCAAATATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918775218_918775225 30 Left 918775218 1:188620183-188620205 CCATTCCACTATGTGAAAACACA No data
Right 918775225 1:188620236-188620258 TCTCAAGTCATCAAATATGCTGG No data
918775220_918775225 25 Left 918775220 1:188620188-188620210 CCACTATGTGAAAACACATGGAA No data
Right 918775225 1:188620236-188620258 TCTCAAGTCATCAAATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918775225 Original CRISPR TCTCAAGTCATCAAATATGC TGG Intergenic
No off target data available for this crispr