ID: 918775240

View in Genome Browser
Species Human (GRCh38)
Location 1:188620417-188620439
Sequence CTGTGGAAGTAAATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918775235_918775240 2 Left 918775235 1:188620392-188620414 CCATTGCTATAACAAATACCTAA No data
Right 918775240 1:188620417-188620439 CTGTGGAAGTAAATGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918775240 Original CRISPR CTGTGGAAGTAAATGGAACT GGG Intergenic
No off target data available for this crispr