ID: 918781015

View in Genome Browser
Species Human (GRCh38)
Location 1:188701248-188701270
Sequence ATTATGGCAAAGTCGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918781011_918781015 10 Left 918781011 1:188701215-188701237 CCTCAGTGGCTTGGGGTAAACTT No data
Right 918781015 1:188701248-188701270 ATTATGGCAAAGTCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918781015 Original CRISPR ATTATGGCAAAGTCGTGCTG GGG Intergenic
No off target data available for this crispr