ID: 918799378

View in Genome Browser
Species Human (GRCh38)
Location 1:188953252-188953274
Sequence GACAGAGAGGGGGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918799366_918799378 27 Left 918799366 1:188953202-188953224 CCACATACTCATGAACATGTGAG No data
Right 918799378 1:188953252-188953274 GACAGAGAGGGGGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918799378 Original CRISPR GACAGAGAGGGGGCTGCAGC AGG Intergenic
No off target data available for this crispr