ID: 918803377

View in Genome Browser
Species Human (GRCh38)
Location 1:189002837-189002859
Sequence AGGAAGAAATGAATGGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918803377_918803383 13 Left 918803377 1:189002837-189002859 CCCGGAGCCATTCATTTCTTCCT No data
Right 918803383 1:189002873-189002895 ATTTCACGAACAAAATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918803377 Original CRISPR AGGAAGAAATGAATGGCTCC GGG (reversed) Intergenic
No off target data available for this crispr