ID: 918805736

View in Genome Browser
Species Human (GRCh38)
Location 1:189040943-189040965
Sequence CTTTCTCTTTACTGCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918805736_918805742 29 Left 918805736 1:189040943-189040965 CCCCCACTGCAGTAAAGAGAAAG No data
Right 918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG No data
918805736_918805740 12 Left 918805736 1:189040943-189040965 CCCCCACTGCAGTAAAGAGAAAG No data
Right 918805740 1:189040978-189041000 ATAAGAAACAAGTTTAATCCAGG No data
918805736_918805741 22 Left 918805736 1:189040943-189040965 CCCCCACTGCAGTAAAGAGAAAG No data
Right 918805741 1:189040988-189041010 AGTTTAATCCAGGTTGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918805736 Original CRISPR CTTTCTCTTTACTGCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr