ID: 918805738

View in Genome Browser
Species Human (GRCh38)
Location 1:189040945-189040967
Sequence TACTTTCTCTTTACTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918805738_918805741 20 Left 918805738 1:189040945-189040967 CCCACTGCAGTAAAGAGAAAGTA No data
Right 918805741 1:189040988-189041010 AGTTTAATCCAGGTTGTTTATGG No data
918805738_918805742 27 Left 918805738 1:189040945-189040967 CCCACTGCAGTAAAGAGAAAGTA No data
Right 918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG No data
918805738_918805740 10 Left 918805738 1:189040945-189040967 CCCACTGCAGTAAAGAGAAAGTA No data
Right 918805740 1:189040978-189041000 ATAAGAAACAAGTTTAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918805738 Original CRISPR TACTTTCTCTTTACTGCAGT GGG (reversed) Intergenic
No off target data available for this crispr