ID: 918805739 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:189040946-189040968 |
Sequence | ATACTTTCTCTTTACTGCAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
918805739_918805740 | 9 | Left | 918805739 | 1:189040946-189040968 | CCACTGCAGTAAAGAGAAAGTAT | No data | ||
Right | 918805740 | 1:189040978-189041000 | ATAAGAAACAAGTTTAATCCAGG | No data | ||||
918805739_918805741 | 19 | Left | 918805739 | 1:189040946-189040968 | CCACTGCAGTAAAGAGAAAGTAT | No data | ||
Right | 918805741 | 1:189040988-189041010 | AGTTTAATCCAGGTTGTTTATGG | No data | ||||
918805739_918805742 | 26 | Left | 918805739 | 1:189040946-189040968 | CCACTGCAGTAAAGAGAAAGTAT | No data | ||
Right | 918805742 | 1:189040995-189041017 | TCCAGGTTGTTTATGGCATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
918805739 | Original CRISPR | ATACTTTCTCTTTACTGCAG TGG (reversed) | Intergenic | ||