ID: 918805740

View in Genome Browser
Species Human (GRCh38)
Location 1:189040978-189041000
Sequence ATAAGAAACAAGTTTAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918805738_918805740 10 Left 918805738 1:189040945-189040967 CCCACTGCAGTAAAGAGAAAGTA No data
Right 918805740 1:189040978-189041000 ATAAGAAACAAGTTTAATCCAGG No data
918805737_918805740 11 Left 918805737 1:189040944-189040966 CCCCACTGCAGTAAAGAGAAAGT No data
Right 918805740 1:189040978-189041000 ATAAGAAACAAGTTTAATCCAGG No data
918805735_918805740 23 Left 918805735 1:189040932-189040954 CCATTATTTTTCCCCCACTGCAG No data
Right 918805740 1:189040978-189041000 ATAAGAAACAAGTTTAATCCAGG No data
918805739_918805740 9 Left 918805739 1:189040946-189040968 CCACTGCAGTAAAGAGAAAGTAT No data
Right 918805740 1:189040978-189041000 ATAAGAAACAAGTTTAATCCAGG No data
918805736_918805740 12 Left 918805736 1:189040943-189040965 CCCCCACTGCAGTAAAGAGAAAG No data
Right 918805740 1:189040978-189041000 ATAAGAAACAAGTTTAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918805740 Original CRISPR ATAAGAAACAAGTTTAATCC AGG Intergenic
No off target data available for this crispr