ID: 918805742

View in Genome Browser
Species Human (GRCh38)
Location 1:189040995-189041017
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918805739_918805742 26 Left 918805739 1:189040946-189040968 CCACTGCAGTAAAGAGAAAGTAT No data
Right 918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG No data
918805737_918805742 28 Left 918805737 1:189040944-189040966 CCCCACTGCAGTAAAGAGAAAGT No data
Right 918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG No data
918805736_918805742 29 Left 918805736 1:189040943-189040965 CCCCCACTGCAGTAAAGAGAAAG No data
Right 918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG No data
918805738_918805742 27 Left 918805738 1:189040945-189040967 CCCACTGCAGTAAAGAGAAAGTA No data
Right 918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type