ID: 918814902

View in Genome Browser
Species Human (GRCh38)
Location 1:189169852-189169874
Sequence TAGGTCTCCTTGGGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918814902_918814909 -3 Left 918814902 1:189169852-189169874 CCATTTTTCCCCAAGGAGACCTA No data
Right 918814909 1:189169872-189169894 CTATGACTGGCTTTTTACCAGGG No data
918814902_918814908 -4 Left 918814902 1:189169852-189169874 CCATTTTTCCCCAAGGAGACCTA No data
Right 918814908 1:189169871-189169893 CCTATGACTGGCTTTTTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918814902 Original CRISPR TAGGTCTCCTTGGGGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr