ID: 918815077

View in Genome Browser
Species Human (GRCh38)
Location 1:189171226-189171248
Sequence AGTTACCTGCAGAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918815077_918815082 16 Left 918815077 1:189171226-189171248 CCAGCCATCTTCTGCAGGTAACT No data
Right 918815082 1:189171265-189171287 CCAGCTCTTGGTCTGTTACTGGG No data
918815077_918815079 4 Left 918815077 1:189171226-189171248 CCAGCCATCTTCTGCAGGTAACT No data
Right 918815079 1:189171253-189171275 TCTTTTTGAGAACCAGCTCTTGG No data
918815077_918815083 22 Left 918815077 1:189171226-189171248 CCAGCCATCTTCTGCAGGTAACT No data
Right 918815083 1:189171271-189171293 CTTGGTCTGTTACTGGGCTTTGG 0: 14
1: 178
2: 170
3: 117
4: 237
918815077_918815084 25 Left 918815077 1:189171226-189171248 CCAGCCATCTTCTGCAGGTAACT No data
Right 918815084 1:189171274-189171296 GGTCTGTTACTGGGCTTTGGTGG 0: 17
1: 155
2: 153
3: 106
4: 231
918815077_918815080 15 Left 918815077 1:189171226-189171248 CCAGCCATCTTCTGCAGGTAACT No data
Right 918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918815077 Original CRISPR AGTTACCTGCAGAAGATGGC TGG (reversed) Intergenic
No off target data available for this crispr