ID: 918815080

View in Genome Browser
Species Human (GRCh38)
Location 1:189171264-189171286
Sequence ACCAGCTCTTGGTCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918815076_918815080 16 Left 918815076 1:189171225-189171247 CCCAGCCATCTTCTGCAGGTAAC No data
Right 918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG No data
918815078_918815080 11 Left 918815078 1:189171230-189171252 CCATCTTCTGCAGGTAACTACTC No data
Right 918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG No data
918815077_918815080 15 Left 918815077 1:189171226-189171248 CCAGCCATCTTCTGCAGGTAACT No data
Right 918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918815080 Original CRISPR ACCAGCTCTTGGTCTGTTAC TGG Intergenic
No off target data available for this crispr