ID: 918820963

View in Genome Browser
Species Human (GRCh38)
Location 1:189253724-189253746
Sequence AATAGTTAACAGAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918820957_918820963 -4 Left 918820957 1:189253705-189253727 CCGCGGTAGAAAGGGGATTAATA No data
Right 918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918820963 Original CRISPR AATAGTTAACAGAAGGAGGG GGG Intergenic
No off target data available for this crispr