ID: 918827998

View in Genome Browser
Species Human (GRCh38)
Location 1:189352198-189352220
Sequence CTCCTGTGAATAGGAACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918827996_918827998 9 Left 918827996 1:189352166-189352188 CCATGCAGATATTCTGGTAGAGA No data
Right 918827998 1:189352198-189352220 CTCCTGTGAATAGGAACAAGTGG No data
918827994_918827998 19 Left 918827994 1:189352156-189352178 CCAGAGCAGACCATGCAGATATT No data
Right 918827998 1:189352198-189352220 CTCCTGTGAATAGGAACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918827998 Original CRISPR CTCCTGTGAATAGGAACAAG TGG Intergenic
No off target data available for this crispr