ID: 918829612

View in Genome Browser
Species Human (GRCh38)
Location 1:189376876-189376898
Sequence CGGGAGGATCACTTGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 424361
Summary {0: 540, 1: 10403, 2: 65364, 3: 158095, 4: 189959}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829612_918829619 0 Left 918829612 1:189376876-189376898 CCTGACCTCAAGTGATCCTCCCG 0: 540
1: 10403
2: 65364
3: 158095
4: 189959
Right 918829619 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG 0: 188
1: 8908
2: 148346
3: 290571
4: 212257
918829612_918829622 25 Left 918829612 1:189376876-189376898 CCTGACCTCAAGTGATCCTCCCG 0: 540
1: 10403
2: 65364
3: 158095
4: 189959
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829612 Original CRISPR CGGGAGGATCACTTGAGGTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr