ID: 918829612

View in Genome Browser
Species Human (GRCh38)
Location 1:189376876-189376898
Sequence CGGGAGGATCACTTGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829612_918829622 25 Left 918829612 1:189376876-189376898 CCTGACCTCAAGTGATCCTCCCG No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829612_918829619 0 Left 918829612 1:189376876-189376898 CCTGACCTCAAGTGATCCTCCCG No data
Right 918829619 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829612 Original CRISPR CGGGAGGATCACTTGAGGTC AGG (reversed) Intergenic