ID: 918829613

View in Genome Browser
Species Human (GRCh38)
Location 1:189376881-189376903
Sequence CGAGGCGGGAGGATCACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829613_918829619 -5 Left 918829613 1:189376881-189376903 CCTCAAGTGATCCTCCCGCCTCG No data
Right 918829619 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG No data
918829613_918829622 20 Left 918829613 1:189376881-189376903 CCTCAAGTGATCCTCCCGCCTCG No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829613 Original CRISPR CGAGGCGGGAGGATCACTTG AGG (reversed) Intergenic