ID: 918829615

View in Genome Browser
Species Human (GRCh38)
Location 1:189376892-189376914
Sequence TTTTGGAAGGCCGAGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829615_918829622 9 Left 918829615 1:189376892-189376914 CCTCCCGCCTCGGCCTTCCAAAA No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829615 Original CRISPR TTTTGGAAGGCCGAGGCGGG AGG (reversed) Intergenic