ID: 918829616

View in Genome Browser
Species Human (GRCh38)
Location 1:189376895-189376917
Sequence GCATTTTGGAAGGCCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596737
Summary {0: 116, 1: 5945, 2: 105189, 3: 241515, 4: 243972}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829616_918829622 6 Left 918829616 1:189376895-189376917 CCCGCCTCGGCCTTCCAAAATGC 0: 116
1: 5945
2: 105189
3: 241515
4: 243972
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829616 Original CRISPR GCATTTTGGAAGGCCGAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr