ID: 918829617

View in Genome Browser
Species Human (GRCh38)
Location 1:189376896-189376918
Sequence AGCATTTTGGAAGGCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 440940
Summary {0: 121, 1: 6102, 2: 106113, 3: 194940, 4: 133664}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829617_918829622 5 Left 918829617 1:189376896-189376918 CCGCCTCGGCCTTCCAAAATGCT 0: 121
1: 6102
2: 106113
3: 194940
4: 133664
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829617 Original CRISPR AGCATTTTGGAAGGCCGAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr