ID: 918829618

View in Genome Browser
Species Human (GRCh38)
Location 1:189376899-189376921
Sequence CCTAGCATTTTGGAAGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475243
Summary {0: 19, 1: 840, 2: 18083, 3: 164257, 4: 292044}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829618_918829622 2 Left 918829618 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG 0: 19
1: 840
2: 18083
3: 164257
4: 292044
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829618 Original CRISPR CCTAGCATTTTGGAAGGCCG AGG (reversed) Intergenic
Too many off-targets to display for this crispr