ID: 918829619

View in Genome Browser
Species Human (GRCh38)
Location 1:189376899-189376921
Sequence CCTCGGCCTTCCAAAATGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829612_918829619 0 Left 918829612 1:189376876-189376898 CCTGACCTCAAGTGATCCTCCCG No data
Right 918829619 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG No data
918829611_918829619 27 Left 918829611 1:189376849-189376871 CCATGTTGGTCAGGCTGGTCTCA No data
Right 918829619 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG No data
918829613_918829619 -5 Left 918829613 1:189376881-189376903 CCTCAAGTGATCCTCCCGCCTCG No data
Right 918829619 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829619 Original CRISPR CCTCGGCCTTCCAAAATGCT AGG Intergenic