ID: 918829619 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:189376899-189376921 |
| Sequence | CCTCGGCCTTCCAAAATGCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918829612_918829619 | 0 | Left | 918829612 | 1:189376876-189376898 | CCTGACCTCAAGTGATCCTCCCG | No data | ||
| Right | 918829619 | 1:189376899-189376921 | CCTCGGCCTTCCAAAATGCTAGG | No data | ||||
| 918829611_918829619 | 27 | Left | 918829611 | 1:189376849-189376871 | CCATGTTGGTCAGGCTGGTCTCA | No data | ||
| Right | 918829619 | 1:189376899-189376921 | CCTCGGCCTTCCAAAATGCTAGG | No data | ||||
| 918829613_918829619 | -5 | Left | 918829613 | 1:189376881-189376903 | CCTCAAGTGATCCTCCCGCCTCG | No data | ||
| Right | 918829619 | 1:189376899-189376921 | CCTCGGCCTTCCAAAATGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918829619 | Original CRISPR | CCTCGGCCTTCCAAAATGCT AGG | Intergenic | ||