ID: 918829620

View in Genome Browser
Species Human (GRCh38)
Location 1:189376905-189376927
Sequence TGTAATCCTAGCATTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 655289
Summary {0: 68, 1: 2937, 2: 49957, 3: 346657, 4: 255670}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829620_918829622 -4 Left 918829620 1:189376905-189376927 CCTTCCAAAATGCTAGGATTACA 0: 68
1: 2937
2: 49957
3: 346657
4: 255670
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829620 Original CRISPR TGTAATCCTAGCATTTTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr