ID: 918829621

View in Genome Browser
Species Human (GRCh38)
Location 1:189376909-189376931
Sequence GTTGTGTAATCCTAGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829621_918829622 -8 Left 918829621 1:189376909-189376931 CCAAAATGCTAGGATTACACAAC No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829621 Original CRISPR GTTGTGTAATCCTAGCATTT TGG (reversed) Intergenic