ID: 918829622

View in Genome Browser
Species Human (GRCh38)
Location 1:189376924-189376946
Sequence TACACAACCTCACTTATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829620_918829622 -4 Left 918829620 1:189376905-189376927 CCTTCCAAAATGCTAGGATTACA No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829613_918829622 20 Left 918829613 1:189376881-189376903 CCTCAAGTGATCCTCCCGCCTCG No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829618_918829622 2 Left 918829618 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829621_918829622 -8 Left 918829621 1:189376909-189376931 CCAAAATGCTAGGATTACACAAC No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829615_918829622 9 Left 918829615 1:189376892-189376914 CCTCCCGCCTCGGCCTTCCAAAA No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829612_918829622 25 Left 918829612 1:189376876-189376898 CCTGACCTCAAGTGATCCTCCCG No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829617_918829622 5 Left 918829617 1:189376896-189376918 CCGCCTCGGCCTTCCAAAATGCT No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829616_918829622 6 Left 918829616 1:189376895-189376917 CCCGCCTCGGCCTTCCAAAATGC No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829622 Original CRISPR TACACAACCTCACTTATTTC TGG Intergenic