ID: 918829622

View in Genome Browser
Species Human (GRCh38)
Location 1:189376924-189376946
Sequence TACACAACCTCACTTATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918829612_918829622 25 Left 918829612 1:189376876-189376898 CCTGACCTCAAGTGATCCTCCCG 0: 540
1: 10403
2: 65364
3: 158095
4: 189959
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829617_918829622 5 Left 918829617 1:189376896-189376918 CCGCCTCGGCCTTCCAAAATGCT 0: 121
1: 6102
2: 106113
3: 194940
4: 133664
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829621_918829622 -8 Left 918829621 1:189376909-189376931 CCAAAATGCTAGGATTACACAAC No data
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829618_918829622 2 Left 918829618 1:189376899-189376921 CCTCGGCCTTCCAAAATGCTAGG 0: 19
1: 840
2: 18083
3: 164257
4: 292044
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829613_918829622 20 Left 918829613 1:189376881-189376903 CCTCAAGTGATCCTCCCGCCTCG 0: 239
1: 4734
2: 34615
3: 96527
4: 132744
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829620_918829622 -4 Left 918829620 1:189376905-189376927 CCTTCCAAAATGCTAGGATTACA 0: 68
1: 2937
2: 49957
3: 346657
4: 255670
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829616_918829622 6 Left 918829616 1:189376895-189376917 CCCGCCTCGGCCTTCCAAAATGC 0: 116
1: 5945
2: 105189
3: 241515
4: 243972
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data
918829615_918829622 9 Left 918829615 1:189376892-189376914 CCTCCCGCCTCGGCCTTCCAAAA 0: 39
1: 2382
2: 50094
3: 141201
4: 206670
Right 918829622 1:189376924-189376946 TACACAACCTCACTTATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918829622 Original CRISPR TACACAACCTCACTTATTTC TGG Intergenic
No off target data available for this crispr