ID: 918832934

View in Genome Browser
Species Human (GRCh38)
Location 1:189422076-189422098
Sequence ATAGGCAAGCAGAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918832934_918832937 6 Left 918832934 1:189422076-189422098 CCTTCTTCATTCTGCTTGCCTAT No data
Right 918832937 1:189422105-189422127 GTGATAACCCTTGAAGTTGGAGG No data
918832934_918832938 11 Left 918832934 1:189422076-189422098 CCTTCTTCATTCTGCTTGCCTAT No data
Right 918832938 1:189422110-189422132 AACCCTTGAAGTTGGAGGCCAGG No data
918832934_918832936 3 Left 918832934 1:189422076-189422098 CCTTCTTCATTCTGCTTGCCTAT No data
Right 918832936 1:189422102-189422124 TGAGTGATAACCCTTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918832934 Original CRISPR ATAGGCAAGCAGAATGAAGA AGG (reversed) Intergenic
No off target data available for this crispr