ID: 918838597

View in Genome Browser
Species Human (GRCh38)
Location 1:189504001-189504023
Sequence CTTTCTAATTACCCAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918838596_918838597 19 Left 918838596 1:189503959-189503981 CCATTGAGCTTAAAGGAGAAAAT No data
Right 918838597 1:189504001-189504023 CTTTCTAATTACCCAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918838597 Original CRISPR CTTTCTAATTACCCAGATTA TGG Intergenic
No off target data available for this crispr