ID: 918843920

View in Genome Browser
Species Human (GRCh38)
Location 1:189583909-189583931
Sequence AGGAAATAAATAACTATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918843920_918843922 24 Left 918843920 1:189583909-189583931 CCAGTTATAGTTATTTATTTCCT No data
Right 918843922 1:189583956-189583978 CAAAGTAATGCCCTTGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918843920 Original CRISPR AGGAAATAAATAACTATAAC TGG (reversed) Intergenic
No off target data available for this crispr