ID: 918843921

View in Genome Browser
Species Human (GRCh38)
Location 1:189583929-189583951
Sequence GAGAAGTCACAGAGTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918843921_918843922 4 Left 918843921 1:189583929-189583951 CCTTGTTCACTCTGTGACTTCTC No data
Right 918843922 1:189583956-189583978 CAAAGTAATGCCCTTGAGAGTGG No data
918843921_918843925 28 Left 918843921 1:189583929-189583951 CCTTGTTCACTCTGTGACTTCTC No data
Right 918843925 1:189583980-189584002 CACATAGTCTGTTTTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918843921 Original CRISPR GAGAAGTCACAGAGTGAACA AGG (reversed) Intergenic
No off target data available for this crispr