ID: 918851356

View in Genome Browser
Species Human (GRCh38)
Location 1:189694501-189694523
Sequence CAGCCTCCCCTCGATGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918851350_918851356 3 Left 918851350 1:189694475-189694497 CCCGGGTTCACGCCATTCTCCTG 0: 37093
1: 46298
2: 105708
3: 170327
4: 158548
Right 918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG No data
918851351_918851356 2 Left 918851351 1:189694476-189694498 CCGGGTTCACGCCATTCTCCTGC 0: 36674
1: 36995
2: 93190
3: 120512
4: 83657
Right 918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG No data
918851352_918851356 -9 Left 918851352 1:189694487-189694509 CCATTCTCCTGCCTCAGCCTCCC 0: 61556
1: 45979
2: 19513
3: 9543
4: 8794
Right 918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG No data
918851348_918851356 9 Left 918851348 1:189694469-189694491 CCACCTCCCGGGTTCACGCCATT 0: 21181
1: 34916
2: 51956
3: 105863
4: 111389
Right 918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG No data
918851349_918851356 6 Left 918851349 1:189694472-189694494 CCTCCCGGGTTCACGCCATTCTC 0: 24823
1: 42722
2: 72727
3: 161215
4: 177363
Right 918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918851356 Original CRISPR CAGCCTCCCCTCGATGGCAG AGG Intergenic
No off target data available for this crispr